download one of these very big text files from the Human Genome Project
https://archive.org/search.php?query=cr ... Project%22
such as Chromosome Number 02 with size 243 MB:
https://archive.org/details/chromosomenumber11776gut
it contains data like this:
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
.... millions of mysterious code written using an unknown programming language and its output is a 3D Human being in a 3D space
try to make this code a music, or a painting, or a source for "special random numbers" or,or... who know what can be found.
it is said the genome data is the same for all the people by 99.9% and what is different is that small part. while chromosome 4 is exactly the same for all the people. look:
https://www.quora.com/If-everyone-has-d ... letely-map
Human Genome Project data files
Re: Human Genome Project data files
oQ ?
A human cell just contains a 9 kilobytes equivalent core genome, not anymore I think... (in the cell core I say)
A rest (near 27 kilobytes equivalent) is swimming around the core in the same cell.
And all the cells have the same "datas" : it is a copy.
Differences between cells in the same body are just created by copy errors or genetic attacks.
I am surprised by so much megabytes...
Also a ratio of 0.01% to differenciate each person is too small. It lets only 9 bytes to differenciate ourselves, however it allows 2^72 combinations, it is too small.
What about a 18 trisomic which has gained 600 bytes in the first cellular divisions?
A good ratio : 3/4 scientific studies in the History are not executed in the right rules.
A human cell just contains a 9 kilobytes equivalent core genome, not anymore I think... (in the cell core I say)
A rest (near 27 kilobytes equivalent) is swimming around the core in the same cell.
And all the cells have the same "datas" : it is a copy.
Differences between cells in the same body are just created by copy errors or genetic attacks.
I am surprised by so much megabytes...
Also a ratio of 0.01% to differenciate each person is too small. It lets only 9 bytes to differenciate ourselves, however it allows 2^72 combinations, it is too small.
What about a 18 trisomic which has gained 600 bytes in the first cellular divisions?
A good ratio : 3/4 scientific studies in the History are not executed in the right rules.