It is currently Thu Aug 22, 2019 12:23 am

All times are UTC + 1 hour




Post new topic Reply to topic  [ 2 posts ] 
Author Message
 Post subject: Human Genome Project data files
PostPosted: Tue Feb 20, 2018 11:00 am 
Offline
Addict
Addict

Joined: Sun Jun 25, 2006 7:28 pm
Posts: 1355
download one of these very big text files from the Human Genome Project
https://archive.org/search.php?query=cr ... Project%22
such as Chromosome Number 02 with size 243 MB:
https://archive.org/details/chromosomenumber11776gut
it contains data like this:
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
.... millions of mysterious code written using an unknown programming language and its output is a 3D Human being in a 3D space
try to make this code a music, or a painting, or a source for "special random numbers" or,or... who know what can be found.
it is said the genome data is the same for all the people by 99.9% and what is different is that small part. while chromosome 4 is exactly the same for all the people. look:
https://www.quora.com/If-everyone-has-d ... letely-map


Top
 Profile  
Reply with quote  
 Post subject: Re: Human Genome Project data files
PostPosted: Tue Apr 17, 2018 5:39 pm 
Offline
Enthusiast
Enthusiast
User avatar

Joined: Tue Sep 22, 2009 10:41 pm
Posts: 424
oQ ?

A human cell just contains a 9 kilobytes equivalent core genome, not anymore I think... (in the cell core I say)

A rest (near 27 kilobytes equivalent) is swimming around the core in the same cell.

And all the cells have the same "datas" : it is a copy.
Differences between cells in the same body are just created by copy errors or genetic attacks.

I am surprised by so much megabytes...
Also a ratio of 0.01% to differenciate each person is too small. It lets only 9 bytes to differenciate ourselves, however it allows 2^72 combinations, it is too small.

What about a 18 trisomic which has gained 600 bytes in the first cellular divisions?

A good ratio : 3/4 scientific studies in the History are not executed in the right rules.


Top
 Profile  
Reply with quote  
Display posts from previous:  Sort by  
Post new topic Reply to topic  [ 2 posts ] 

All times are UTC + 1 hour


Who is online

Users browsing this forum: No registered users and 4 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum

Search for:
Jump to:  

 


Powered by phpBB © 2008 phpBB Group
subSilver+ theme by Canver Software, sponsor Sanal Modifiye